Lokus D1S80 diwariskan oleh orang tua kepada anaknya. Lokus ini terdiri atas urutan-urutan DNA dengan ulangan (repeat) dan panjang yang sangat bervariasi untuk setiap orang misalnya AGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTC (10x).  lokus ini memiliki sifat polimorfik yang menyebabkan perbedaan alel ini untuk setiap manusia. Lokus ini digunakan untuk untuk identifikasi individu dengan sidik jari DNA. Sidik jari genetik merupakan salah satu contoh aplikasi untuk mengidentifikasi secara pasti terdakwa kasus kriminal atau uji paternitas. Hanya untuk kembar identik, teknik ini tidak dapat digunakan karena kembar identik memiliki gen yang identik. Dalam suatu kasus kriminal, sidik jari genetik menyediakan bukti tentang identitas tersangka yang diduga sebagai pelaku kejahatan.

Digunakan primer D1S80 karena DNA yang akan diisolasi dan akan diperbanyak mengandung lokus D1S80. Lokus ini digunakan sebagai situs awal untuk sintesis DNA. Air hasil kumur mengandung mukosa rongga mulut dan enzim-enzim. Saat sentrifugasi, sel-sel berpindah kea rah luar karena beratnya. Penambahan bufer lisis adalah sebagai detergen yang melarutkan sel. (KAC) mengandung potassium asetat yang dapat mengendapkan protein. Etanol 70% digunakan untuk mencuci DNA dari residu potassium asetat. Proses selanjutnya adalah PCR (Polymerase Chain Reaction), denaturasi pada suhu 90 ˚C selama 60 detik menyebabkan heliks ganda DNA akan mengalami disosiasi. Proses annealing pada suhu 63 ˚C selama 60 detik menyebabkan primer-primer akan berikatan dengan DNA pada tempat yang tepat. Proses sintesis DNA pada suhu 72 ˚C selama 60 detik menyebabkan taq polumerase memanjangkan primerprimer sesuai dengan utas DNA cetakan. Proses PCR diulang sebanyak 30 kali, dan putaran terakhir berlangsung selama 5 menit pada suhu 72 ˚C. Hasil menunjukkan pita-pita terlihat dengan jelas melalui proses elektroforesis. Dapat dilihat bahwa ukuran pita berbeda-beda antar individu yang menandakan kekerabatan antar individu pun tidak dekat.

Rayap termasuk binatang Arthropoda, kelas Insekta dari ordo Isoptera yang dalam perkembangan hidupnya mengalami metamorfosa graduil atau bertahap. Kelompok serangga ini pertumbuhannya melalui tiga tahap yaitu tahap telur, tahap nimfa dan tahap dewasa. Perkembangan hidup rayap adalah melalui metamorfosa hemimetabola, yaitu secara bertahap, yang secara teori melalui stadium (tahap pertumbuhan) telur, nimfa dan dewasa. Walaupun stadium dewasa pada serangga umumnya terdiri atas individu-individu bersayap (laron), karena sifat polimorfismenya maka di samping bentuk laron yang bersayap, stadium dewasa rayap mencakup juga kasta pekerja yang bentuknya seperti nimfa yang berwarna keputih-putihan, dan kasta prajurit yang berbentuk khusus dan berwarna lebih kecoklatan. Rayap pohon membangun rumahnya atau yang disebut lorong kembara di area batang pohon. Biasanya pohon yang digunakan adalah pohon yang telah mati, kering yang hanya tertinggal kayunya saja. Rayap jenis ini disebut dengan rayap kayu kering (Cryptotermes) yang menghuni dan makan kayu kering (Howse 1970).

Rayap merupakan binatang yang hidup berkoloni dalam jumlah yang sangat banyak. Rayap membangun sarangnya sebagai tempat untuk hidup, mencari makanan dan berkembang biak. Seluruh kehidupan rayap dilakukan di dalam sarangnya. Dalam setiap koloni terdapat milyaran individu yang terbagi ke dalam kasta-kasta dengan tugas yang berbeda-beda. Kasta reproduksi dimiliki rayap ratu dan raja. Ratu dan raja bertugas dalam hal reproduksi. Ratu dapat bertahan hidup hingga 25 tahun dan menghasilkan jutaan telur. Telur-telur yang menetas akan menghasilkan kasta rayap lain. Ciri-ciri yang khas dari rayap ratu yaitu memiliki bentuk perut (abdomen) yang besar (hingga sebesar ibu jari) yang mengandung ribuan telur. Ratu ini tinggal di tengah-tengah sarang bersama rayap raja, hidup untuk makan dan bereproduksi.

Rayap pekerja berjumlah ribuan dan hanya bertugas untuk mencari makan bagi koloninya. Pekerja selalu bergerak vertikal hingga menemukan makanannya di luar sarang, dengan membangun jalur-jalur yang terbuat dari tanah. Mereka mengeluarkan cairan protein dari tubuhnya sehingga semua jalur yang dilalui rayap pekerja akan ditumbuhi jamur. Jamur-jamur ini dapat mensintesis benda apapun (seperti kayu) sehingga dapat menjadi lapuk. Rayap pekerja mengambil makanannya (zat kayu atau selulosa) kemudian membawanya kembali ke sarang untuk memberikan makan pada sang ratu. Rayap tentara ini adalah kasta yang melindungi koloninya dari musuh alami yaitu semut. Rayap ini akan mengawal para pekerja dalam mencari makan. Ciri khas dari kasta tentara adalah memiliki kepala lebih besar berwarna gelap dan memiliki capit. Laron merupakan kasta reproduksi, yaitu rayap bersayap yang terbang dan bereproduksi. Mereka akan membentuk pasangan-pasangan jantan dan betina, melepaskan sayapnya dan melangsungkan perkawinan untuk membentuk koloni baru. Setiap sepasang jantan dan betina akan membangun satu koloni baru (Subekti 2005).

Rayap mempunyai sifat dan perilaku kriptobiotik, trofalaksis, kanibalistik, dan nekrologi. Sifat kriptobiotik adalah sifat yang ingin selalu menyembunyikan diri dan menjauhi cahaya. Akibat dari sifat ini rayap selau bersembunyi di tempat gelap, dan bila terpaksa harus berjalan di tempat terbuka, mereka membuat pelindung atau liang kembara (Tarumingkeng 2000).

Aklimasi adalah proses adaptasi fisiologi yang terjadi secara artifisial

Aklimatisasi adalah adaptasi proses fisiologi terhadap berbagai keadaan lingkungan yang terjadi secara alamiah.

Adaptasi adalah cara bagaimana organisme mengatasi tekanan lingkungan sekitarnya untuk bertahan hidup. Organisme yang mampu beradaptasi terhadap lingkungannya mampu untuk memperoleh air, udara dan nutrisi (makanan),mengatasi kondisi fisik lingkungan seperti temperatur, cahaya dan panas, mempertahankan hidup dari musuh alaminya, bereproduksi, dan merespon perubahan yang terjadi di sekitarnya.